 |
 |

Apolipoprotein E Gene and Age-Related Maculopathy in Older IndividualsThe Cardiovascular Health Study
Gabriella Tikellis, PhD;
Cong Sun, MD, MPH;
Michael B. Gorin, MD, PhD;
Ronald Klein, MD, MPH;
Barbara E. K. Klein, MD, MPH;
Emily K. Marino Larsen, MS;
David S. Siscovick, MD, MPH;
Larry D. Hubbard, MAT;
Tien Y. Wong, MD, PhD
Arch Ophthalmol. 2007;125(1):68-73.
ABSTRACT
 |  |
Objective To examine the association between the apolipoprotein E (APOE) gene and age-related maculopathy (ARM) in an older population.
Methods Two thousand one hundred seventy persons 65 years and older sampled from 4 US communities had ARM signs assessed from retinal photographs using a modified Wisconsin Age-Related Maculopathy Grading System. DNA extracted from blood samples was analyzed for common APOE alleles.
Results After controlling for age, sex, cigarette smoking, and other factors, white participants carrying the 2 allele had an increased risk of late ARM (odds ratio, 2.53 [95% confidence interval, 1.08-5.90]) while carriers of the 4 allele had a lower risk of late ARM (odds ratio, 0.69 [95% confidence interval, 0.19-2.50]). There were too few late ARM cases in African American individuals for analysis.
Conclusion APOE polymorphism is associated with late ARM in older white persons 65 years and older. Consistent with previous studies, the APOE 2 allele is associated with a significant increased risk of late ARM development, whereas the 4 allele may confer some protection.
INTRODUCTION
Age-related maculopathy (ARM) is a leading cause of visual impairment in the elderly population.1 Genetic predisposition to ARM has been hypothesized,2 and specific genes (eg, complement factor H) have recently been identified.3-5
The apolipoprotein E (APOE) gene, a major apolipoprotein of the central nervous system and a key regulator of lipid transport,6 has been linked with a variety of neurodegenerative and cardiovascular disorders, including Alzheimer disease7 and stroke,8 and is another attractive candidate gene to investigate possible links with ARM. However, previous studies that have examined the association of the APOE gene and ARM have shown somewhat inconsistent results.9-18 Of the 3 common alleles of APOE ( 2, 3, and 4), the 4 carrier has been inversely associated with late ARM in some,9-13,16 but not all,14-15 studies, whereas the 2 carrier may be associated with an increased ARM risk.9, 12, 16-17
The majority of these studies have been clinic based, and few population-based data are available.9 Further, there have been suggestions that the relationship between APOE and ARM is modified by age and possibly race.3, 11, 14-15,17 In particular, 1 study showed a significant protective association of the 4 carrier and ARM only among participants younger than 70 years and not in older persons.17 It was suggested that genetic factors may play a less important role in the pathogenesis of ARM in older people.
The Cardiovascular Health Study (CHS) is a population-based study of white and African American persons 65 years and older at baseline.19 We have previously reported the prevalence of ARM in the CHS.20 In the current study, we examine its association with APOE.
METHODS
STUDY POPULATION
The CHS has been previously described.19 The original cohort recruited 5201 persons in 1989-1990 in 4 field centers: Forsyth County, North Carolina; Washington County, Maryland; Sacramento County, California; and Pittsburgh, Pa. An additional 687 eligible African American individuals were recruited from Forsyth County, Sacramento County, and Pittsburgh in 1992-1993.21 This report used data from the 1997-1998 examination, when retinal photography was first performed.20 Of the 4249 participants (95.6% of survivors) who were contacted for this examination, we excluded 29 participants whose race was neither white nor African American, 491 without APOE data, and 1559 who were not examined in the clinic and did not have retinal photography or who had ungradeable photographs, leaving 2170 who provided data for the current analysis. Differences between persons with and without gradable retinal photographs have been previously reported.20 In general, persons who did not have retinal photography or had ungradeable photographs were older and, while controlling for age, were more likely to be African American and female; to have diabetes mellitus and hypertension; and to be current cigarette smokers. There were no significant age-adjusted differences between those included and excluded with regard to body mass index, hypertension status, systolic blood pressure, plasma total cholesterol level, high-density lipoprotein (HDL) cholesterol level, low-density lipoprotein cholesterol level, and common carotid intima media thickness.20
ARM GRADING AND DEFINITIONS
The retinal photography procedure and retinal grading have been previously reported.20, 22 Briefly, a 45° nonmydriatic retinal photograph of 1 randomly selected eye of each participant was taken at the follow-up examination following 5 minutes of dark adaptation. The photograph was centered on the region of the optic disc and the macula. The photographs were sent to the University of Wisconsin Fundus Reading Center, Madison, for assessment and grading of ARM. Trained graders masked to the subject identity evaluated the photographs using a modification of the Wisconsin Age-Related Maculopathy Grading System.23
For grading, a grid consisting of 2 circles concentric with the center of the macula and 4 radial lines was superimposed over the photograph. The presence of soft drusen, retinal pigment epithelial depigmentation, increased retinal pigment, pure geographic atrophy, and signs of exudative macular degeneration (subretinal hemorrhage, subretinal fibrous scar, retinal pigment epithelial detachment, and/or serous detachment of the sensory retina) were determined in the macular area circumscribed by the outermost circle of the grading grid. The circle had a radius that corresponded to 3450 µm in the fundus of an average eye.
Soft drusen were defined as those having a diameter larger than 63 µm. Retinal pigment epithelial depigmentation, increased retinal pigment associated with ARM (the presence of granules or clumps of gray or black pigment in or beneath the retina), and pigmentary abnormalities were defined as present or absent/questionable. Early ARM was defined as the presence of either soft drusen alone, retinal pigment epithelial de pigmentation alone, or a combination of soft drusen with increased retinal pigment and/or depigmentation in the absence of late ARM.20, 23 Late ARM was defined as the presence of signs of exudative ARM degeneration or pure geographic atrophy.20, 23
APOE GENOTYPING
Genotyping of APOE in the CHS has been previously described.24-25 Only participants who gave consent for DNA use for noncardiovascular outcomes were included in this analysis. We analyzed separately the 3 common carriers of APOE ( 2, 3, and 4) and its 6 common genotypes. The 3 major allelic forms of the APOE gene were determined in the Core Molecular Genetics facility at the University of Vermont College of Medicine by the method of Hixson and Vernier.26 The 2 primers used for polymerase chain reaction amplification, done in 96-well microtiter plates, were 5'GGCACGGCTGTCCAAGGA3' and 5'ACAGAATTCGCCCCGGCCTGGTACAC3'. Amplitaq T4 DNA polymerase was obtained from Perkin-Elmer (Wellesley, Mass); the restriction enzyme HhaI was obtained from New England BioLabs (Ipswich, Mass). DNA samples known to be 4/ 2 and 2/ 3 were analyzed with each batch as positive controls. The restriction patterns were determined with the use of agarose electrophoresis.26
DEFINITION OF OTHER VARIABLES
Participants underwent clinical and laboratory assessment of cardiovascular diseases and its risk factors during the course of the study.27-29 Relevant portions are highlighted herein. Blood pressures were taken according to a standardized protocol.27 Hypertension was defined as systolic blood pressure of 140 mm Hg or higher, diastolic blood pressure of 90 mm Hg or higher, or the combination of self-reported high blood pressure diagnosis and use of antihypertensive medications. Medical history, medication use, cigarette smoking, and alcohol consumption status were ascertained from questionnaires. Technicians assessed body mass index (calculated as weight in kilograms divided by height in meters squared) and the waist-hip ratio. Blood collection, processing, and definitions for fasting glucose level; total, low-density lipoprotein, and HDL cholesterol levels; and triglyceride level are described elsewhere.19 All variables defined were based on the 1997-1998 clinic examination, concurrent with retinal photography, except data on most blood chemistry results and body measurements, which were taken from the 1992-1993 examination.
STATISTICAL ANALYSIS
We examined whether the distribution of APOE carriers (any 2, 3, and 4) and specific genotypes by presence or absence of ARM was in Hardy-Weinberg equilibrium using the 2 test. Where the reliability of P values based on 2 approximations was questionable, we report P values for Fisher exact test. We calculated odds ratios (ORs) and 95% confidence intervals (CIs) for ARM by APOE genotype frequency using the ancestral 3/ 3 as the reference group in logistic regression models. In the multivariate analysis, we adjusted for age, sex, race, cigarette smoking, hypertension, and glucose and total triglyceride levels for models of early ARM and age, sex, race, cigarette smoking, hypertension, and HDL cholesterol level for late ARM. Because genotype frequency differed by race, analyses were also performed separately in white individuals and African American individuals.
Finally, APOE variation was also modeled in a risk score model, because risk scores have been demonstrated to increase power in modeling genetic exposures.30 Because previous studies suggested 4 conferred protection while 2 increased risk, a genotypic risk scoring system was devised to test this hypothesis, which respectively assigned +1, 0, or –1 risk units for each 2, 3, or 4 carrier of an individual with genotypes (scores) of 2/ 2 (+2), 2/ 3 (+1), 2/ 4 (+0), 3/ 3 (+0), 3/ 4 (–1), and 4/ 4 (–2). All P values are 2-sided and STATA 8.2 (StataCorp, College Station, Tex) was used for all analyses.
RESULTS
Characteristics between persons with early ARM (n = 336) or late ARM (n = 28) compared with those with no ARM (n = 1806) are presented in Table 1. In general, persons with early ARM were significantly older, less likely to be African American, and had a higher plasma glucose level than persons without ARM, while persons with late ARM were significantly older and had a significantly higher plasma HDL cholesterol level compared with those with no ARM. All other characteristics were not associated with any ARM status.
|
|
|
|
Table 1. Participant Characteristics by Presence of Early and Late ARM*
|
|
|
Table 2 shows the prevalence of no ARM, early and late ARM, and specific early ARM signs by APOE allele carrier and genotype status. The APOE carrier and genotype distribution did not differ significantly between subjects with early ARM or early ARM signs compared with those with no ARM.
|
|
|
|
Table 2. Distribution of APOE Allele and Genotype by Specific ARM Signs
|
|
|
The prevalence of early and late ARM as compared with no ARM by APOE allele carrier and genotype status in white and African American individuals is presented in Table 3. Overall, 3/ 3 was the dominant genotype and 3, the dominant allele carrier in both white and African American individuals. White individuals with late ARM were more likely to have the 2 allele (18.5%) and less likely to have the 4 allele (7.4%) as compared with white individuals with no ARM (8.7% and 12.6%; P<.05 for both comparisons). African American individuals with early ARM were more likely to carry the 2 allele (24.1%) as compared with those with no ARM (13.4%; P<.05).
|
|
|
|
Table 3. Distribution of APOE Allele and Genotype by Early and Late ARM in White and African American Individuals
|
|
|
Table 4 shows multivariate logistic regression models of early and late ARM, controlling for age, sex, race, cigarette smoking, and other factors. In all persons, white individuals, and African American individuals, neither 2 carriers nor 4 carriers were associated with early ARM. In all persons and white individuals, 2 carriers were more likely to have late ARM (OR, 2.53 for both groups) after multivariable adjustment, while the 4 carrier was associated with a slightly decreased but not significant risk of late ARM in all persons (OR, 0.89 [95% CI, 0.28-2.79]) and in white individuals (OR, 0.69 [95% CI, 0.19-2.50]).
|
|
|
|
Table 4. Association of APOE Carrier and Genotype With Early or Late ARM in All Persons, White Individuals, and African American Individuals*
|
|
|
The results of the logistic regression models for early and late ARM by APOE risk score are shown in Table 4. There was a significant association between increasing APOE score and late ARM in white individuals (OR, 1.87 [95% CI, 1.01-3.47]) after controlling for other factors, but no associations were found for early ARM.
Finally, Table 4 shows that in comparison with the 3/ 3 genotype, the 2/ 3 genotype was associated with an increased risk of having late ARM in all persons (OR, 2.74 [95% CI, 1.14-6.58]) and in white individuals (OR, 2.78 [95% CI, 1.16-6.67])
COMMENT
Mounting evidence from molecular investigations,10, 31 animal models,32 and epidemiologic studies9-13,16-17 indicates that APOE is associated with ARM development. Previous studies that have examined a possible relationship between APOE and ARM have suggested a lower risk of ARM9-13,16 in carriers of the 4 allele while, less consistently, the 2 carrier appears to confer an increased risk of ARM.9, 12, 16-17 Our results concur with these findings in that the frequency of carrying the 4 allele was significantly lower and the frequency of carrying the 2 allele was significantly higher in white individuals with late ARM as compared with white individuals with no ARM. After adjusting for age, sex, cigarette smoking, total triglyceride level, and hypertension, we observed a 2.5-fold increased risk in all persons and white individuals with late ARM if they were carriers of the 2 allele and a nonsignificant 31% decrease in risk for white individuals of having late ARM if they were 4 carriers.
Because 1 study reported a significant protective association of the 4 carrier and ARM only among participants younger than 70 years,17 it has been suggested that genetic factors may play a more important role in the etiology of ARM in younger people. Our current study, however, shows that APOE polymorphism may still have a significant role in late ARM development in older persons (mean age of 78 years in the current study).
With regard to early ARM, we did not find a consistent pattern of association with APOE. In particular, we found no evidence that the 4 carrier was associated with a lower risk or that the 2 carrier was associated with a higher risk of early ARM. It is possible that the lack of a consistent association of APOE and early ARM in our study reflects the more prominent role of APOE on the development of late ARM signs only. This was also observed by Baird and colleagues,12 in which significant associations of APOE 2 and 4 with ARM were confined to late disease.
One of the purposes of this study was to investigate possible racial variation in the association of APOE and ARM. In contrast to white populations, the association between APOE and ARM has been inconsistent in studies of other ethnic groups such as Chinese14 and Italian16 populations. In our study, there was a significant difference in the distribution of the APOE genotype in African American individuals with early ARM as compared with those with no ARM. In fact, African American subjects with the 2/ 4 genotype had an almost 7-fold higher risk of early ARM compared with those who had the 3/ 3 genotype (multivariate adjusted OR, 6.42 [95% CI, 1.47-28.12], data not shown). This association was not seen in white individuals, where ARM was more prevalent.
In a recent report by Schmidt et al,33 the possible association between exudative ARM and APOE 2 carriers was suggested to be stronger in cigarette smokers compared with people who had never smoked, although the finding was not significant. In our cohort, we also examined the association of APOE and early ARM in persons who were current or previous cigarette smokers compared with those who were never smokers. The multivariate adjusted odds of having early ARM among participants who were 2 carriers was increased but not significantly so among participants who had a history of smoking (OR, 1.40 [95% CI, 0.89-2.20]). In contrast, participants who were 2 carriers and had never smoked were at a reduced risk of having early ARM (OR, 0.80 [95% CI, 0.50-1.27]). Larger epidemiologic studies are required to provide further evidence to support these findings.
The current study has a number of strengths. These include a population drawn from the community, a large sample size, standardized ARM evaluation from photographs, and detailed information on a variety of potential risk factors. Several important limitations should also be mentioned. First, the CHS used a 45° nonstereoscopic fundus photograph taken through nonpharmacologically dilated pupils to determine the presence of ARM. Thus, the sensitivity related to the detection of ARM (in particular, early ARM signs) is more likely to be lower compared with the prevalence of ARM assessed from photographs taken with pharmacologically dilated pupils. Similarly, the grading of ARM is more variable when assessed through nonpharmacologically dilated pupils compared with the grading of 30° stereoscopic fundus photographs taken through dilated pupils.34 In addition, because the CHS was primarily interested in examining the value of retinal vascular signs in the prediction of cardiovascular disease, only 1 randomly selected eye was photographed. This may lead to an increased variability of ARM detection, which in turn increases the likelihood of measurement error and misclassification. However, misclassification of the small number of "false-negative" cases (ie, true ARM cases misclassified as noncases) is unlikely to substantially bias the results except toward the null.
Second, selection bias may have obscured associations because the study population was derived from the cohort examined 10 years from the baseline. If persons with ARM and the 2 or 4 carrier were less likely to participate in this examination because of higher mortality, Alzheimer disease, or other reasons, the potential ARM-APOE association could be falsely distorted.
Finally, as noted earlier, we did not have sufficient cases of late ARM in African American individuals to analyze potential associations with APOE. In fact, the CHS population had a lower prevalence of late ARM cases in both racial groups analyzed (1.3%) compared with other population-based studies, such as the Beaver Dam Eye Study (1.6%)35 and the Blue Mountains Eye Study (1.9%).36 The lower prevalence may be attributed to the use of a nonmydriatic camera, which resulted in less ARM being detected, or the fact that retinal photographs were only taken at the 10-year follow-up examination when many of the participants who may have had late ARM (and thus were more likely to be older) were either unable to attend the examination because of poor health or may have died in the interim or, alternatively, the CHS population may have a lower prevalence of late ARM cases.
In conclusion, in this older, population-based cohort, we showed that the 2 carrier may be associated with an increased risk of developing late ARM. While the 4 carrier appears to confer some protection, the association was not statistically significant. These findings were largely confined to white persons.
AUTHOR INFORMATION
Correspondence: Tien Y. Wong, MD, PhD, Retinal Vascular Imaging Centre, Centre for Eye Research Australia, University of Melbourne, 32 Gisborne St, East Melbourne 3002, Australia (twong{at}unimelb.edu.au).
Submitted for Publication: October 27, 2005; final revision received February 15, 2006; accepted February 22, 2006.
Financial Disclosure: None reported.
Funding/Support: This work was supported by Cardiovascular Health Study contract NHLBI HC-97-06 from the National Heart, Lung and Blood Institute (NHLBI), National Institutes of Health (NIH), Bethesda, Md. Additional support was provided by grant R21-HL077166 from NHLBI, NIH and the Sylvia and Charles Viertel Clinical Investigator Award (Dr Wong).
Author Affiliations: Centre for Eye Research Australia, University of Melbourne, Victoria (Drs Tikellis, Sun, and Wong); Department of Ophthalmology, University of Pittsburgh, Pittsburgh, Pa (Dr Gorin and Mr Hubbard); Department of Ophthalmology, University of Wisconsin, Madison (Drs R. Klein and B. E. K. Klein); Departments of Biostatistics (Ms Larsen) and Medicine and Epidemiology (Dr Siscovick), University of Washington, Seattle; Singapore Eye Research Institute, National University of Singapore, Singapore (Dr Wong).
REFERENCES
 |  |
1. Tielsch JM, Sommer A, Witt K, Katz J, Royall RM. Blindness and visual impairment in an American urban population: the Baltimore Eye Survey. Arch Ophthalmol. 1990;108:286-290.
FREE FULL TEXT
2. Gorin MB, Breitner JC, De Jong PT; et al. The genetics of age-related macular degeneration. Mol Vis. 1999;5:29.
PUBMED
3. Haines JL, Hauser MA, Schmidt S; et al. Complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308:419-421.
FREE FULL TEXT
4. Klein RJ, Zeiss C, Chew EY; et al. Complement factor H polymorphism in age-related macular degeneration. Science. 2005;308:385-389.
FREE FULL TEXT
5. Edwards AO, Ritter R III, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308:421-424.
FREE FULL TEXT
6. Mahley RW. Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 1988;240:622-630.
FREE FULL TEXT
7. Evans DA, Beckett LA, Field TS; et al. Apolipoprotein E epsilon4 and incidence of Alzheimer disease in a community population of older persons. JAMA. 1997;277:822-824.
FREE FULL TEXT
8. Slooter AJ, Tang MX, van Duijn CM; et al. Apolipoprotein E epsilon4 and the risk of dementia with stroke: a population-based investigation. JAMA. 1997;277:818-821.
FREE FULL TEXT
9. Klaver CC, Kliffen M, van Duijn CM; et al. Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet. 1998;63:200-206.
FULL TEXT
|
ISI
| PUBMED
10. Souied EH, Benlian P, Amouyel P; et al. The epsilon4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol. 1998;125:353-359.
FULL TEXT
|
ISI
| PUBMED
11. Schmidt S, Klaver C, Saunders A; et al. A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet. 2002;23:209-223.
FULL TEXT
| PUBMED
12. Baird PN, Guida E, Chu DT, Vu HT, Guymer RH. The epsilon2 and epsilon4 alleles of the apolipoprotein gene are associated with age-related macular degeneration. Invest Ophthalmol Vis Sci. 2004;45:1311-1315.
FREE FULL TEXT
13. Zareparsi S, Reddick AC, Branham KE; et al. Association of apolipoprotein E alleles with susceptibility to age-related macular degeneration in a large cohort from a single center. Invest Ophthalmol Vis Sci. 2004;45:1306-1310.
FREE FULL TEXT
14. Pang CP, Baum L, Chan WM, Lau TC, Poon PM, Lam DS. The apolipoprotein E epsilon4 allele is unlikely to be a major risk factor of age-related macular degeneration in Chinese. Ophthalmologica. 2000;214:289-291.
FULL TEXT
|
ISI
| PUBMED
15. Schultz DW, Klein ML, Humpert A; et al. Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol. 2003;121:679-683.
FREE FULL TEXT
16. Simonelli F, Margaglione M, Testa F; et al. Apolipoprotein E polymorphisms in age-related macular degeneration in an Italian population. Ophthalmic Res. 2001;33:325-328.
FULL TEXT
|
ISI
| PUBMED
17. Schmidt S, Saunders AM, De La Paz MA; et al. Association of the apolipoprotein E gene with age-related macular degeneration: possible effect modification by family history, age, and gender. Mol Vis. 2000;6:287-293.
ISI
| PUBMED
18. Wong TY, Shankar A, Klein R; et al. Apolipoprotein E gene and early age-related maculopathy: the Atherosclerosis Risk in Communities Study. Ophthalmology. 2006;113:255-259.
FULL TEXT
|
ISI
| PUBMED
19. Fried LP, Borhani NO, Enright P; et al. The Cardiovascular Health Study: design and rationale. Ann Epidemiol. 1991;1:263-276.
PUBMED
20. Klein R, Klein BE, Marino EK; et al. Early age-related maculopathy in the cardiovascular health study. Ophthalmology. 2003;110:25-33.
FULL TEXT
|
ISI
| PUBMED
21. Tell GS, Fried LP, Hermanson B; et al. Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol. 1993;3:358-366.
PUBMED
22. Wong TY, Hubbard LD, Klein R; et al. Retinal microvascular abnormalities and blood pressure in older people: the Cardiovascular Health Study. Br J Ophthalmol. 2002;86:1007-1013.
FREE FULL TEXT
23. Klein R, Davis MD, Magli YL, Segal P, Klein BE, Hubbard L. The Wisconsin age-related maculopathy grading system. Ophthalmology. 1991;98:1128-1134.
ISI
| PUBMED
24. Kuller LH, Shemanski L, Manolio T; et al. Relationship between ApoE, MRI findings, and cognitive function in the Cardiovascular Health Study. Stroke. 1998;29:388-398.
FREE FULL TEXT
25. Haan MN, Shemanski L, Jagust WJ, Manolio TA, Kuller L. The role of APOE epsilon4 in modulating effects of other risk factors for cognitive decline in elderly persons. JAMA. 1999;282:40-46.
FREE FULL TEXT
26. Hixson JE, Vernier D. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res. 1990;31:545-548.
ABSTRACT
27. Tell GS, Rutan GH, Kronmal RA; et al. Correlates of blood pressure in community-dwelling older adults: the Cardiovascular Health Study. Cardiovascular Health Study (CHS) Collaborative Research Group. Hypertension. 1994;23:59-67.
FREE FULL TEXT
28. Robbins J, Wahl P, Savage P; et al. Hematological and biochemical laboratory values in older Cardiovascular Health Study participants. J Am Geriatr Soc. 1995;43:855-859.
ISI
| PUBMED
29. Cushman M, Cornell ES, Howard PR; et al. Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem. 1995;41:264-270.
FREE FULL TEXT
30. Kaslow RA, Carrington M, Apple R; et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nat Med. 1996;2:405-411.
FULL TEXT
|
ISI
| PUBMED
31. Anderson DH, Ozaki S, Nealon M; et al. Local cellular sources of apolipoprotein E in the human retina and retinal pigmented epithelium: implications for the process of drusen formation. Am J Ophthalmol. 2001;131:767-781.
FULL TEXT
|
ISI
| PUBMED
32. Elizabeth Rakoczy P, Yu MJ, Nusinowitz S, Chang B, Heckenlibely JR. Mouse models of age-related macular degeneration. Exp Eye Res. 2006;82:741-752.
FULL TEXT
|
ISI
| PUBMED
33. Schmidt S, Haines JL, Postel EA; et al. Joint effects of smoking history and APOE genotypes in age-related macular degeneration. Mol Vis. 2005;11:941-949.
ISI
| PUBMED
34. Klein R, Meuer SM, Moss SE, Klein BEK. Detection of drusen and early signs of age-related maculopathy using a nonmydriatic camera and a standard fundus camera. Ophthalmology. 1992;99:1686-1692.
ISI
| PUBMED
35. Klein R, Klein BEK, Linton KL. Prevalence of age-related maculopathy: the Beaver Dam Eye Study. Ophthalmology. 1992;99:933-943.
ISI
| PUBMED
36. Mitchell P, Smith W, Attebo K, Wang JJ. Prevalence of age-related maculopathy in Australia: the Blue Mountains Eye Study. Ophthalmology. 1995;102:1450-1460.
ISI
| PUBMED
SECTION EDITOR: LESLIE HYMAN, PhD
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
Early Age-Related Macular Degeneration, Cognitive Function, and Dementia: The Cardiovascular Health Study
Baker et al.
Arch Ophthalmol 2009;127:667-673.
ABSTRACT
| FULL TEXT
The lipofuscin fluorophore A2E perturbs cholesterol metabolism in retinal pigment epithelial cells
Lakkaraju et al.
Proc. Natl. Acad. Sci. USA 2007;104:11026-11031.
ABSTRACT
| FULL TEXT
|